View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8299_low_19 (Length: 238)
Name: NF8299_low_19
Description: NF8299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8299_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 3959570 - 3959792
Alignment:
| Q |
1 |
tggtttgtagtttgccaaaaatatatgccccttttcctctcaaatttccatttcctcctttttgtaaaaacctaaataagaaaaaccccaatgaggtggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3959570 |
tggtttgtagtttgccaaaaatatatgccccttttcctctcaaatttccatttcctcctttttgtaaaaacctaaataagaaaaaccccaatgatgtggt |
3959669 |
T |
 |
| Q |
101 |
ccagaatttttcgttcattcatgtttggaaacccgaatgactataataaccgctagaaacccttcacaatgtggaaattggcagcaaaacattggtttca |
200 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3959670 |
ccagaattttttgttcattcatgtatggaaacccgaatgactataataaccgctagaaaccctttacaatgtggaaattggcagcaaaacattggtttca |
3959769 |
T |
 |
| Q |
201 |
aaattattttggtacatatatat |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
3959770 |
aaattattttggtacatatatat |
3959792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 126 - 191
Target Start/End: Complemental strand, 4021260 - 4021195
Alignment:
| Q |
126 |
tggaaacccgaatgactataataaccgctagaaacccttcacaatgtggaaattggcagcaaaaca |
191 |
Q |
| |
|
||||||||| ||||||| ||| |||| | |||||||||||| |||||||||||||||||||||| |
|
|
| T |
4021260 |
tggaaaccctaatgactctaacaaccaccagaaacccttcaggttgtggaaattggcagcaaaaca |
4021195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University