View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8299_low_21 (Length: 230)
Name: NF8299_low_21
Description: NF8299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8299_low_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 59 - 214
Target Start/End: Complemental strand, 34265987 - 34265831
Alignment:
| Q |
59 |
atatcattaattattactaagcaatgatgtatttttcgatcaatatgcttcccttttattaaaaaatatgaaaatataacatatagtaaatgatacaaca |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34265987 |
atatcattaattattactaagcaatgatgtatttttcgatcaatatgcttcctttttattaaaaaatatgaaaatataacatatagtaaatgatacaaca |
34265888 |
T |
 |
| Q |
159 |
agaaactat-nnnnnnnngttgtataaaatctaagataattacttatagaatttctt |
214 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34265887 |
agaaactataaaaaaaaagttgtataaaatctaagataattacttatagaatttctt |
34265831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 17 - 55
Target Start/End: Complemental strand, 34267173 - 34267135
Alignment:
| Q |
17 |
agaaaagtaacaaaagtggtatgtaaaaaacacaaatgt |
55 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34267173 |
agaaaagtaacaaaagtggcatgtaaaaaacacaaatgt |
34267135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University