View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8299_low_25 (Length: 214)
Name: NF8299_low_25
Description: NF8299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8299_low_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 13 - 116
Target Start/End: Original strand, 41584132 - 41584235
Alignment:
| Q |
13 |
gaagcagagaaaaagaaacatgaatataataatttatgagatgaaatcgaaataatgattttggaattaaagcaaaagagaatccgtaaaacgaatcttc |
112 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41584132 |
gaagcacagaaaaagaaacatgaatataataatttatgagaagaaatcgaaataatgattttggaattaaagcaaaagagaatccgtaaaacgaatcttc |
41584231 |
T |
 |
| Q |
113 |
ttac |
116 |
Q |
| |
|
|||| |
|
|
| T |
41584232 |
ttac |
41584235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University