View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8299_low_26 (Length: 211)
Name: NF8299_low_26
Description: NF8299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8299_low_26 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 188
Target Start/End: Complemental strand, 26276064 - 26275877
Alignment:
| Q |
1 |
tcttacgaaaaggggctgtaagattgtgtcaattttctgtttctgtcatcaacatgaagaaaaatccactcatatattcttcagctgcccagaaacgcag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26276064 |
tcttacgaaaaggggctgtaagattgtgtcaattttctgtttctgtcatcaacatgaagaaaaatccactcatatattcttcagctgcccagaaacgcag |
26275965 |
T |
|
| Q |
101 |
aagctttggcagaggttgtgtactgggattgaccaaggcccggactgctccggtggctgaatgtgattgacagttgtgttggtaattg |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26275964 |
aagctttggcagaggttgtgtactgggattgaccaaggcccggactgctccggtggctgaatgtgattgacagttgtgttggtaattg |
26275877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 38 - 96
Target Start/End: Complemental strand, 43673469 - 43673411
Alignment:
| Q |
38 |
tgtttctgtcatcaacatgaagaaaaatccactcatatattcttcagctgcccagaaac |
96 |
Q |
| |
|
||||||||||||||||||||||||| |||| |||||| |||||||||||||||||||| |
|
|
| T |
43673469 |
tgtttctgtcatcaacatgaagaaacctccagtcatattttcttcagctgcccagaaac |
43673411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University