View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8300_low_19 (Length: 320)
Name: NF8300_low_19
Description: NF8300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8300_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 43 - 303
Target Start/End: Complemental strand, 2915458 - 2915207
Alignment:
| Q |
43 |
agtaaatcccagatgataaacctgactgcagttctgattgatacactttgattctgcctctccaactatgttgagaatatccattttggaatatggcaaa |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2915458 |
agtaaatcccagatgataaacctgactgcagttctgattgattcactttgattctgcctctccaactatgttgagaat---------ggaatatggcaaa |
2915368 |
T |
 |
| Q |
143 |
taaagcatttcagagatgataatattcttgggtgcagcttattatattttcttatgagaatttgtatattaatattaacgtagagacaatagagtccaag |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2915367 |
taaagcatttcagagatgataatattcttgggtgcagcttattatattttcttatgagaatttgtatattaatattaccgtagagacaatagagtccaag |
2915268 |
T |
 |
| Q |
243 |
tcatgaacgtaatgcaactaaatggagacaatgtagtaaatactttgtgttgttgatgttt |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2915267 |
tcatgaacgtaatgcaactaaatggagacaatgtagtaaatactttgtgttgttgatgttt |
2915207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University