View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8300_low_25 (Length: 240)
Name: NF8300_low_25
Description: NF8300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8300_low_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 57 - 228
Target Start/End: Original strand, 43555111 - 43555280
Alignment:
| Q |
57 |
aattaataaagctagctagaaaaatctagcaccgaagaagatattattaccaacacaagcatcaagatgttcacctaccgtggtttagggttttggttct |
156 |
Q |
| |
|
|||||| |||||||||||||||| ||||| || || || ||||||||||||| |||| ||||||||| ||||||||||| | ||||||||||||||||| |
|
|
| T |
43555111 |
aattaacaaagctagctagaaaa-tctagtactgagga-gatattattaccagcacaggcatcaagacgttcacctacccttgtttagggttttggttcc |
43555208 |
T |
 |
| Q |
157 |
tttgtcccttttgatgctaatgggtgtagtcaccttgtgtatatccacaagagatcgatgtttcttcttctc |
228 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
43555209 |
tttgtcccttttgatgctaatgcgtgtagtcaccttgtgtatatccacaagagatcgatatttcttcatctc |
43555280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University