View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8300_low_29 (Length: 206)
Name: NF8300_low_29
Description: NF8300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8300_low_29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 18 - 186
Target Start/End: Original strand, 38427926 - 38428094
Alignment:
| Q |
18 |
tcatagatggaactattaatatggggagcccatagcaaatacatcgttgctataaaagtacaatattatagcactatggaaataaatatgcatatactta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38427926 |
tcatagatggaactattaatatggggagcccatagcaaatacattgttgctataaaagtacaatattatagcactatggaaataaatatgcatatactta |
38428025 |
T |
|
| Q |
118 |
gagcctaagaattcgagatagtggagatatatatgagtaggtaatgccttgtgtcaatttttatgcaat |
186 |
Q |
| |
|
|||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38428026 |
gagcttaagaattcgagatagtggagatatacatgagtaggtaatgccttgtgtcaatttttatgcaat |
38428094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University