View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8301_high_10 (Length: 239)
Name: NF8301_high_10
Description: NF8301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8301_high_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 1 - 124
Target Start/End: Complemental strand, 41584154 - 41584031
Alignment:
| Q |
1 |
tcatgtttctttttctgtgcttcgattaacatgcaatttctctgtttacctggatatgaaattaacttaatctgattcaatgtttcctaatccatgtgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41584154 |
tcatgtttctttttctgtgcttcgattaacatgcaatttctctgtttacctggatatgaaattaacttaatctgattcaatgtttcctaatccatgtgaa |
41584055 |
T |
 |
| Q |
101 |
attaaacgcgacatttactgatga |
124 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
41584054 |
attaaacgcgacatttactgatga |
41584031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University