View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8301_high_2 (Length: 526)

Name: NF8301_high_2
Description: NF8301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8301_high_2
NF8301_high_2
[»] chr6 (1 HSPs)
chr6 (421-519)||(2919148-2919246)


Alignment Details
Target: chr6 (Bit Score: 99; Significance: 1e-48; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 421 - 519
Target Start/End: Complemental strand, 2919246 - 2919148
Alignment:
421 tgatgagaaaaatattctactacttatattctattttctagctagcataattaactggaactttgttatagagcattgaagggttgcctttgatgtcca 519  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2919246 tgatgagaaaaatattctactacttatattctattttctagctagcataattaactggaactttgttatagagcattgaagggttgcctttgatgtcca 2919148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University