View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8301_low_11 (Length: 239)

Name: NF8301_low_11
Description: NF8301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8301_low_11
NF8301_low_11
[»] chr3 (1 HSPs)
chr3 (1-124)||(41584031-41584154)


Alignment Details
Target: chr3 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 1 - 124
Target Start/End: Complemental strand, 41584154 - 41584031
Alignment:
1 tcatgtttctttttctgtgcttcgattaacatgcaatttctctgtttacctggatatgaaattaacttaatctgattcaatgtttcctaatccatgtgaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41584154 tcatgtttctttttctgtgcttcgattaacatgcaatttctctgtttacctggatatgaaattaacttaatctgattcaatgtttcctaatccatgtgaa 41584055  T
101 attaaacgcgacatttactgatga 124  Q
    ||||||||||||||||||||||||    
41584054 attaaacgcgacatttactgatga 41584031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University