View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8301_low_3 (Length: 526)
Name: NF8301_low_3
Description: NF8301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8301_low_3 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 99; Significance: 1e-48; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 421 - 519
Target Start/End: Complemental strand, 2919246 - 2919148
Alignment:
| Q |
421 |
tgatgagaaaaatattctactacttatattctattttctagctagcataattaactggaactttgttatagagcattgaagggttgcctttgatgtcca |
519 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2919246 |
tgatgagaaaaatattctactacttatattctattttctagctagcataattaactggaactttgttatagagcattgaagggttgcctttgatgtcca |
2919148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University