View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8302_low_1 (Length: 254)
Name: NF8302_low_1
Description: NF8302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8302_low_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 11 - 240
Target Start/End: Complemental strand, 40736282 - 40736051
Alignment:
| Q |
11 |
atcatcaactatacgataggaataacagcaaatacaagcacatccttctccgacatgcccattttttctttcaattcggtacctctatattattttttct |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40736282 |
atcatcaactatacgataggaataacagcaaatacaagcacatccttctccgacatgcccattttttctttcaattcggtacctctatattattttttct |
40736183 |
T |
 |
| Q |
111 |
gatgtaaccttgcaaatcctcgcaggtat--acacgccctaagctatatgtctgaagttttccttgagtacattttttgtaacccttttataactgagtt |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40736182 |
gatgtaaccttgcaagtcctcgcaggtatacacacgccctaagctatatgtctgaagttttccttgagtacattttttgtaacccttttataactgagtt |
40736083 |
T |
 |
| Q |
209 |
ctacttcggtgtaaccggcccgtagctaatga |
240 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |
|
|
| T |
40736082 |
ctacttcggtgtaaccggcccgtaactaatga |
40736051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University