View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8303_low_11 (Length: 217)

Name: NF8303_low_11
Description: NF8303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8303_low_11
NF8303_low_11
[»] chr3 (1 HSPs)
chr3 (49-197)||(39276229-39276383)


Alignment Details
Target: chr3 (Bit Score: 116; Significance: 3e-59; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 49 - 197
Target Start/End: Complemental strand, 39276383 - 39276229
Alignment:
49 aattaaaatttgatagtttcatcattcaaaactgtgttacctccgttcaaacgatattgaagacttatagggtggtgga------aagtaacaactaaca 142  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   |       ||||||||||||||    
39276383 aattaaaatttgatagtttcatcattcaaaactgtgttacctccgttcaaacgatattgaagacttatagggtggaaaatactagtagtaacaactaaca 39276284  T
143 acctactattgaatacacttttggatctaactagtataactaacatttatgtcta 197  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39276283 acctactattgaatacacttttggatctaactagtataactaacatttatgtcta 39276229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University