View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8303_low_3 (Length: 327)
Name: NF8303_low_3
Description: NF8303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8303_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 258; Significance: 1e-143; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 12 - 282
Target Start/End: Complemental strand, 7232836 - 7232564
Alignment:
| Q |
12 |
tggtgagatggaagagttggtaaaatagagacagttggcagttggcacataccaaaatatggtcaattttataaggattaactgtagatgtttcttgtga |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
7232836 |
tggtgagatggaagagttggtaaaatagagacagttggcagttggcacataccaaaatatggtcaattttataaggattaactgtatatgtttcttgtga |
7232737 |
T |
 |
| Q |
112 |
ttataataaaattggttagactttgattttggtcactatataaattttatgagcattattgtatgggcacaatgataggcacttcatttggtcacgagat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7232736 |
ttataataaaattggttagactttgattttggtcactatataaattttatgagcattattgtatgggcacaatgataggcacttcatttggtcacgagat |
7232637 |
T |
 |
| Q |
212 |
atacttcattggacacaagtccaaataaatatagttgggcacaccataaaat--tagagagagaaaaagagaa |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7232636 |
atacttcattggacacaagtccaaataaatatagttgggcacaccataaaatcatagagagagaaaaagagaa |
7232564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University