View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8303_low_7 (Length: 256)
Name: NF8303_low_7
Description: NF8303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8303_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 19505939 - 19506176
Alignment:
| Q |
1 |
ttaattgttgcttatggtaaaggaaaattaacatgcttccttgcagacttagaggcagtttttgatgtggtgagaaggattttacaatttatcttcatta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
19505939 |
ttaattgttgcttatggtaaaggaaaattaacatgcttccttgcagacttagaggcagtttttgatgtggtgagaaggattttacaatttatcttcttta |
19506038 |
T |
|
| Q |
101 |
aacggaaatgaaatattatatattattagttgatattattacacttttggtcttcatatatttaaatacct-nnnnnnntattaatatgatttttggtta |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
19506039 |
aacggaaatgaaatattatatattattagttgatattattacacttttggtcttcatatatttaaatacctaaaaaaaatattaatatgatttttggtta |
19506138 |
T |
|
| Q |
200 |
aacgtcacactttttaagtacttataatatatccatcc |
237 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
19506139 |
aacgtcacaccttttaagtacctataatatatccatcc |
19506176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 10 - 43
Target Start/End: Original strand, 19482393 - 19482426
Alignment:
| Q |
10 |
gcttatggtaaaggaaaattaacatgcttccttg |
43 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |
|
|
| T |
19482393 |
gcttatgggaaaggaaaattaacatgcttccttg |
19482426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 7 - 39
Target Start/End: Complemental strand, 36182267 - 36182235
Alignment:
| Q |
7 |
gttgcttatggtaaaggaaaattaacatgcttc |
39 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
36182267 |
gttgcttatggtaaaggaaaattaacaagcttc |
36182235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University