View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8306_high_2 (Length: 244)
Name: NF8306_high_2
Description: NF8306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8306_high_2 |
 | |
|
| [»] chr6 (3 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 204; Significance: 1e-111; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 17 - 244
Target Start/End: Complemental strand, 4804230 - 4804003
Alignment:
| Q |
17 |
attcactaatacatttgaacaccagtgtggatagctttggaaagaaagaatggtgaagattttctgcattgatgctagatatgtatgggagtccaacaat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| |||||||||| ||||||||||| |||||||||| ||| |
|
|
| T |
4804230 |
attcactaatacatttgaacaccagtgtggataggttaggaaagaaagaatggtgaagatttgctgcattgatactagatatgtaagggagtccaataat |
4804131 |
T |
|
| Q |
117 |
aacagtcattgtatttagatgtccatccattcaagcagctgtcgttgatagagcaatgcagccttgatatatatctcgaaatcgtgcattgcagccttga |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4804130 |
aacagtcattgtatttagatgtccatccattcaagcagctgtcgttgatagagcaatgcagccttgatatatatctcgaaatcgtgcattgcagccttga |
4804031 |
T |
|
| Q |
217 |
atagcaatcaacttcctatctatgagcc |
244 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
4804030 |
atagcaatcaacttcctatctatgagcc |
4804003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 25 - 97
Target Start/End: Original strand, 4797777 - 4797849
Alignment:
| Q |
25 |
atacatttgaacaccagtgtggatagctttggaaagaaagaatggtgaagattttctgcattgatgctagata |
97 |
Q |
| |
|
|||||||||||||||| ||||||||| || |||||| || ||| |||||||||| |||||||| |||| |||| |
|
|
| T |
4797777 |
atacatttgaacaccactgtggataggttaggaaaggaaaaattgtgaagatttgctgcattggtgctggata |
4797849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 187 - 243
Target Start/End: Complemental strand, 10779451 - 10779395
Alignment:
| Q |
187 |
atatctcgaaatcgtgcattgcagccttgaatagcaatcaacttcctatctatgagc |
243 |
Q |
| |
|
|||||||||||||| ||||||||| | ||| | ||||||||||||||||||||||| |
|
|
| T |
10779451 |
atatctcgaaatcgcgcattgcagtgtggaacaacaatcaacttcctatctatgagc |
10779395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University