View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8307_high_16 (Length: 203)
Name: NF8307_high_16
Description: NF8307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8307_high_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 141; Significance: 4e-74; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 1 - 184
Target Start/End: Complemental strand, 1164450 - 1164268
Alignment:
| Q |
1 |
gtctttattgctactaaatactatgtattttggccacaattaatccattagttttcttgttgattatcatcaatttcttaatttgaatttgactgcaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1164450 |
gtctttattgctactaaatactatgtattttggccacaattaatccat-agttttcttgttgattatcatcaatttcttaatttgaatttgactgcaaat |
1164352 |
T |
 |
| Q |
101 |
ttgcaatatgnnnnnnnnncttttcaagtttggaataagtatgaaaatgatagaactagttgcatggagagtaggattgctcac |
184 |
Q |
| |
|
|||| ||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1164351 |
ttgctatatgtttttttttcttttcaagtttgaaataagtatgaaaatgatagaactagttgcatggagagtaggattgctcac |
1164268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 1148320 - 1148256
Alignment:
| Q |
1 |
gtctttattgctactaaatactatgtattttggccacaattaatc-cattagttttcttgttgatta |
66 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| || ||| |||||||||||||||| |
|
|
| T |
1148320 |
gtctttattgctactaaatactatatattttggccacaattagtctcat--gttttcttgttgatta |
1148256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 129 - 184
Target Start/End: Complemental strand, 1171559 - 1171504
Alignment:
| Q |
129 |
tttggaataagtatgaaaatgatagaactagttgcatggagagtaggattgctcac |
184 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| | ||||||||| |||| |
|
|
| T |
1171559 |
tttgaaataagtatgaaaatgatagaactagttgcatgaattgtaggattgttcac |
1171504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 129 - 182
Target Start/End: Complemental strand, 1179860 - 1179807
Alignment:
| Q |
129 |
tttggaataagtatgaaaatgatagaactagttgcatggagagtaggattgctc |
182 |
Q |
| |
|
|||| ||| ||||||||| ||| ||||||||||||||| ||||||| ||||||| |
|
|
| T |
1179860 |
tttgaaatgagtatgaaattgaaagaactagttgcatgtagagtagaattgctc |
1179807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University