View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8307_low_17 (Length: 203)

Name: NF8307_low_17
Description: NF8307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8307_low_17
NF8307_low_17
[»] chr4 (4 HSPs)
chr4 (1-184)||(1164268-1164450)
chr4 (1-66)||(1148256-1148320)
chr4 (129-184)||(1171504-1171559)
chr4 (129-182)||(1179807-1179860)


Alignment Details
Target: chr4 (Bit Score: 141; Significance: 4e-74; HSPs: 4)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 1 - 184
Target Start/End: Complemental strand, 1164450 - 1164268
Alignment:
1 gtctttattgctactaaatactatgtattttggccacaattaatccattagttttcttgttgattatcatcaatttcttaatttgaatttgactgcaaat 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
1164450 gtctttattgctactaaatactatgtattttggccacaattaatccat-agttttcttgttgattatcatcaatttcttaatttgaatttgactgcaaat 1164352  T
101 ttgcaatatgnnnnnnnnncttttcaagtttggaataagtatgaaaatgatagaactagttgcatggagagtaggattgctcac 184  Q
    |||| |||||         ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
1164351 ttgctatatgtttttttttcttttcaagtttgaaataagtatgaaaatgatagaactagttgcatggagagtaggattgctcac 1164268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 1148320 - 1148256
Alignment:
1 gtctttattgctactaaatactatgtattttggccacaattaatc-cattagttttcttgttgatta 66  Q
    |||||||||||||||||||||||| ||||||||||||||||| || |||  ||||||||||||||||    
1148320 gtctttattgctactaaatactatatattttggccacaattagtctcat--gttttcttgttgatta 1148256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 129 - 184
Target Start/End: Complemental strand, 1171559 - 1171504
Alignment:
129 tttggaataagtatgaaaatgatagaactagttgcatggagagtaggattgctcac 184  Q
    |||| ||||||||||||||||||||||||||||||||| |  ||||||||| ||||    
1171559 tttgaaataagtatgaaaatgatagaactagttgcatgaattgtaggattgttcac 1171504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 129 - 182
Target Start/End: Complemental strand, 1179860 - 1179807
Alignment:
129 tttggaataagtatgaaaatgatagaactagttgcatggagagtaggattgctc 182  Q
    |||| ||| ||||||||| ||| ||||||||||||||| ||||||| |||||||    
1179860 tttgaaatgagtatgaaattgaaagaactagttgcatgtagagtagaattgctc 1179807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University