View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8307_low_7 (Length: 353)
Name: NF8307_low_7
Description: NF8307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8307_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 305; Significance: 1e-171; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 305; E-Value: 1e-171
Query Start/End: Original strand, 19 - 331
Target Start/End: Original strand, 54438565 - 54438877
Alignment:
| Q |
19 |
agaaaggaaggaacacatggaatgggagggttgggggtagtgtcctcaattcaaatagtgtgcggaagggaagatactcaagggagaggttgaaacgtag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54438565 |
agaaaggaaggaacacatggaatgggagggttgggggtagtgtcctcaattcaaatagtgtgtggaagggaagatactcaagggagaggttgaaacgtag |
54438664 |
T |
 |
| Q |
119 |
gttcctcttagtaagcttgctaaaaatggtaaatatggacaaataaaactgggactcaaaatttaagatttcgaaagtttattaataattgttcactccc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
54438665 |
gttcctcttagtaagcttgctaaaaatggtaaatatggacaaataaaactgggactcaaaatttaagatttcgaaagtttattaataattgttcactcac |
54438764 |
T |
 |
| Q |
219 |
aatgttgttataacatttaagttagtggtaagtgaaagtgggggaggttactaacggagaactaatttgttaaatggattgaagatgtttgtcactttga |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54438765 |
aatgttgttataacatttaagttagtggtaagtgaaagtgggggaggttactaacggagaactaatttgttaaatggattgaagatgtttgtcactttga |
54438864 |
T |
 |
| Q |
319 |
ataaagaagaatg |
331 |
Q |
| |
|
||||||||||||| |
|
|
| T |
54438865 |
ataaagaagaatg |
54438877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University