View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8308_high_2 (Length: 396)

Name: NF8308_high_2
Description: NF8308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8308_high_2
NF8308_high_2
[»] chr2 (1 HSPs)
chr2 (17-208)||(22828976-22829167)


Alignment Details
Target: chr2 (Bit Score: 160; Significance: 4e-85; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 160; E-Value: 4e-85
Query Start/End: Original strand, 17 - 208
Target Start/End: Original strand, 22828976 - 22829167
Alignment:
17 aggaaggtgggcactcgatagagacaaggaagaaaatagaaggattaggtttgcattaaggctcaatgttataaggagttctttgcattgattgcatgtt 116  Q
    ||||||||||| |||||| ||||| | |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||    
22828976 aggaaggtgggaactcgacagagagagggaagaaaatagaaggattaggcttgcattaaggctcaatgttataaggagttctttgcattgattgaatgtt 22829075  T
117 gatttttaacttgttttgatgaagaatttgaaagaatgatgagggagggatggaggccgagaggttagagagaatgagagggagtggagttc 208  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||    
22829076 gatttttaacttgttttgatgaagaatttgaaagaatgatgggggagggatggaggccgagaggttagagagaatgagagagagtggagttc 22829167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University