View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8308_high_2 (Length: 396)
Name: NF8308_high_2
Description: NF8308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8308_high_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 160; Significance: 4e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 160; E-Value: 4e-85
Query Start/End: Original strand, 17 - 208
Target Start/End: Original strand, 22828976 - 22829167
Alignment:
| Q |
17 |
aggaaggtgggcactcgatagagacaaggaagaaaatagaaggattaggtttgcattaaggctcaatgttataaggagttctttgcattgattgcatgtt |
116 |
Q |
| |
|
||||||||||| |||||| ||||| | |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
22828976 |
aggaaggtgggaactcgacagagagagggaagaaaatagaaggattaggcttgcattaaggctcaatgttataaggagttctttgcattgattgaatgtt |
22829075 |
T |
 |
| Q |
117 |
gatttttaacttgttttgatgaagaatttgaaagaatgatgagggagggatggaggccgagaggttagagagaatgagagggagtggagttc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
22829076 |
gatttttaacttgttttgatgaagaatttgaaagaatgatgggggagggatggaggccgagaggttagagagaatgagagagagtggagttc |
22829167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University