View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8309_high_3 (Length: 258)
Name: NF8309_high_3
Description: NF8309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8309_high_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 224; Significance: 1e-123; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 11 - 246
Target Start/End: Complemental strand, 9005020 - 9004785
Alignment:
| Q |
11 |
cacagggcccgatgtctcatttgctgtcaacaaactctctcaattcatgcataaacctaccaccctccacttccagcaccttaaaaggttacttaggtac |
110 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
9005020 |
cacacggcccgatgtctcatttgctgtcaacaaactctctcaattcatgcacaaacctaccaccctccacttccagcaccttaaaaggttacttagttac |
9004921 |
T |
 |
| Q |
111 |
ctcaaatcgaccattaactttggtatcatgcttaggaaaccaaactcctttcaacttctcgcctacactgatgctgattggggtggcaatcccgatgatc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9004920 |
ctcaaatcgaccattaactttggtatcatgcttaggaaaccaaactcctttcaacttctcgcctacactgatgctgattggggtggcaatcccgatgatc |
9004821 |
T |
 |
| Q |
211 |
gcacatccacttcagcgtatcttatattttttggtg |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
9004820 |
gcacatccacttcagcgtatcttatattttttggtg |
9004785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 37 - 70
Target Start/End: Original strand, 2662398 - 2662431
Alignment:
| Q |
37 |
tcaacaaactctctcaattcatgcataaacctac |
70 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
2662398 |
tcaacaaactctctcaattcatgcataagcctac |
2662431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 69
Target Start/End: Complemental strand, 40113200 - 40113147
Alignment:
| Q |
16 |
ggcccgatgtctcatttgctgtcaacaaactctctcaattcatgcataaaccta |
69 |
Q |
| |
|
|||| ||| |||||||||| ||||||| ||||| ||||||||||||||||||| |
|
|
| T |
40113200 |
ggcctgatctctcatttgcaatcaacaagctctcccaattcatgcataaaccta |
40113147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 183 - 246
Target Start/End: Complemental strand, 1109184 - 1109121
Alignment:
| Q |
183 |
gctgattggggtggcaatcccgatgatcgcacatccacttcagcgtatcttatattttttggtg |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1109184 |
gctgattggggtggcaatcccgatgatcgcacatccacttcagcgtatcttatattttttggtg |
1109121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 180 - 246
Target Start/End: Complemental strand, 28083546 - 28083480
Alignment:
| Q |
180 |
gatgctgattggggtggcaatcccgatgatcgcacatccacttcagcgtatcttatattttttggtg |
246 |
Q |
| |
|
||||| || ||||||||||||| ||||||||||| ||||| ||||| ||| ||||||||||||||| |
|
|
| T |
28083546 |
gatgccgactggggtggcaatcatgatgatcgcacctccacatcagcatatattatattttttggtg |
28083480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.00000000009; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 180 - 246
Target Start/End: Original strand, 32074034 - 32074100
Alignment:
| Q |
180 |
gatgctgattggggtggcaatcccgatgatcgcacatccacttcagcgtatcttatattttttggtg |
246 |
Q |
| |
|
||||| || ||||||||||||| ||||||||||| ||||| ||||| ||| ||||||||||||||| |
|
|
| T |
32074034 |
gatgccgactggggtggcaatcatgatgatcgcacctccacatcagcatatattatattttttggtg |
32074100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 37 - 70
Target Start/End: Original strand, 3019465 - 3019498
Alignment:
| Q |
37 |
tcaacaaactctctcaattcatgcataaacctac |
70 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
3019465 |
tcaacaaactctctcaattcatgcataagcctac |
3019498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University