View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8309_high_4 (Length: 234)
Name: NF8309_high_4
Description: NF8309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8309_high_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 18 - 218
Target Start/End: Original strand, 278668 - 278868
Alignment:
| Q |
18 |
gtcataagtcattatggagaagctgggaattcatacattaaatggtgtgccgaaatggctttagctcaaaatattggtgtcccatggatcatgtgcaagc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
278668 |
gtcataagtcattatggagaagctgggaattcatacattaaatggtgtgccgaaatggctttagctcaaaatattggtgtcccatggatcatgtgcaagc |
278767 |
T |
 |
| Q |
118 |
nnnnnnntgctccagccactattatcgatacatgcaatggctattattgtgacactttcaagccaaacaatcctaaaagccctaaaatatttaccgagaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
278768 |
aaaaaaatgctccagccactattatcgatacatgcaatggctattattgtgacactttcaagccaaacaatcctaaaagccctaaaatatttacagagaa |
278867 |
T |
 |
| Q |
218 |
t |
218 |
Q |
| |
|
| |
|
|
| T |
278868 |
t |
278868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University