View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8309_high_5 (Length: 229)
Name: NF8309_high_5
Description: NF8309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8309_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 143; Significance: 3e-75; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 5 - 167
Target Start/End: Original strand, 125919 - 126081
Alignment:
| Q |
5 |
cattgctaaccttgtgtctctaaatttataagcaacaggttcaatatggatcatactgctcatatgcatgactaaattgtcatagattgaaggcataatt |
104 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
125919 |
cattactaaccttgtgtctctaaatttataagcaacaggttcaatatggatcatactgctcatatgcacgactaaattatcatagattgaaggcataatt |
126018 |
T |
 |
| Q |
105 |
tctcatcataattgataagttttattaaaaaattcggaattcgcagataacagcaaaataata |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
126019 |
tctcatcataattgataagttttattaaaaaattcggatttcgcagataacagcaaagtaata |
126081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 167 - 222
Target Start/End: Original strand, 126103 - 126158
Alignment:
| Q |
167 |
aaaattttcaggaaacacataaaagtgacgagcatttaaacactttaagcaagaaa |
222 |
Q |
| |
|
|||| ||||||||| ||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
126103 |
aaaaatttcaggaagcacataaaagtgatgagcatttaaacactttaagcaagaaa |
126158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 10 - 45
Target Start/End: Complemental strand, 2691155 - 2691120
Alignment:
| Q |
10 |
ctaaccttgtgtctctaaatttataagcaacaggtt |
45 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
2691155 |
ctaaccttgtgtctctaaatttataagcaacaggtt |
2691120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 159 - 222
Target Start/End: Complemental strand, 9000174 - 9000111
Alignment:
| Q |
159 |
aaaataataaaattttcaggaaacacataaaagtgacgagcatttaaacactttaagcaagaaa |
222 |
Q |
| |
|
|||||||||| ||||||||||| | ||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
9000174 |
aaaataataatattttcaggaagctcataaaagtgatgagcatttaaacactttaagcaagaaa |
9000111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University