View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8309_low_3 (Length: 272)
Name: NF8309_low_3
Description: NF8309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8309_low_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 139; Significance: 8e-73; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 20 - 162
Target Start/End: Original strand, 44200915 - 44201057
Alignment:
| Q |
20 |
ttactcgcaccgagtggtgccttcttccttccccttgattttggggtttttctcgtcattttcaaatctttgaatcttcgattcaagaccagtgaagaag |
119 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44200915 |
ttactcgcaccgagtggtgcctttttccttccccttgattttggggtttttctcgtcattttcaaatctttgaatcttcgattcaagaccagtgaagaag |
44201014 |
T |
 |
| Q |
120 |
atgaagaataatggtagtagtgtgtttggtctttcagaacagt |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44201015 |
atgaagaataatggtagtagtgtgtttggtctttcagaacagt |
44201057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 204 - 256
Target Start/End: Original strand, 44201112 - 44201164
Alignment:
| Q |
204 |
tgttattattatttgggtacggggaagcggaaattattcaaaaaatgcgcggg |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44201112 |
tgttattattatttgggtacggggaagcggaaattattcaaaaaatgcgcggg |
44201164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University