View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8310_low_15 (Length: 218)
Name: NF8310_low_15
Description: NF8310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8310_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 19 - 208
Target Start/End: Complemental strand, 47636465 - 47636276
Alignment:
| Q |
19 |
gtccaatccaacagcctttgtttttcaggatctgaataaattttctattcataagactatgatccccgataaaagtaaaccagtttaatgaaacagaaat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47636465 |
gtccaatccaacagcctttgtttttcaggatctgcataaattttctattcataagactatgatccccgataaaagtaaaccagtttaatgaaacagaaat |
47636366 |
T |
|
| Q |
119 |
ttgacaaaagaattcaattgcacagttttctcatgtgaagtgtgcactataaagagttcagataagatgcacctaccaagaataatatag |
208 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
47636365 |
ttgacaaaagaattcaattgtacagttttctcatgtgaagtgtgcactataaagagttcagataagatgcacctaccaaaaagaatatag |
47636276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University