View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8310_low_16 (Length: 216)
Name: NF8310_low_16
Description: NF8310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8310_low_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 91 - 199
Target Start/End: Original strand, 29465894 - 29466002
Alignment:
| Q |
91 |
gtccaaactcttagaaatgttgctcgtgatggaaggactgttatttcttctattcatcagcctagcagtgaagtctttgcactttttgatgatctcttct |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29465894 |
gtccaaactcttagaaatgttgctcgtgatggaaggactgttatttcttctattcatcagcctagcagtgaagtctttgcactttttgatgatcttttct |
29465993 |
T |
|
| Q |
191 |
tgctctctg |
199 |
Q |
| |
|
||||||||| |
|
|
| T |
29465994 |
tgctctctg |
29466002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 94 - 195
Target Start/End: Original strand, 29433066 - 29433167
Alignment:
| Q |
94 |
caaactcttagaaatgttgctcgtgatggaaggactgttatttcttctattcatcagcctagcagtgaagtctttgcactttttgatgatctcttcttgc |
193 |
Q |
| |
|
|||||||| |||||| |||||| |||||||||||||||||||||||| ||||||||||| | |||||||| |||||||||||||| || || ||||||| |
|
|
| T |
29433066 |
caaactctcagaaatattgctcatgatggaaggactgttatttcttcaattcatcagcccaatagtgaagtatttgcactttttgacgaccttttcttgc |
29433165 |
T |
|
| Q |
194 |
tc |
195 |
Q |
| |
|
|| |
|
|
| T |
29433166 |
tc |
29433167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University