View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8311_low_13 (Length: 242)
Name: NF8311_low_13
Description: NF8311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8311_low_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 21 - 230
Target Start/End: Original strand, 26490825 - 26491034
Alignment:
| Q |
21 |
aacaaagaagaaaactaagtcctcaggaacaaagttccggtagcatcatttcgaaggagaggtcgaagatcatcaggaggtgacgagtgaagcaggaagt |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26490825 |
aacaaagaagaaaactaagtcctcaggaacaaagttccggtagcatcatttcgaaggagaggtcgaagatcatcaggtggtgacgagtgaagcaggaagt |
26490924 |
T |
 |
| Q |
121 |
tagcatcggaggttgcccctaacttggcaaaatagtctgcacaatggttaccttcacgaagagtatgtcgtagtgaaacattcatctgagaaagcttatc |
220 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
26490925 |
tagcatcggatgttgcccctaacttggcaaaatagtctgcacaatggttatcttcacgaagagtatgacgtagcgaaacattcatctgagaaagcttatc |
26491024 |
T |
 |
| Q |
221 |
tttgatgtcc |
230 |
Q |
| |
|
|||||||||| |
|
|
| T |
26491025 |
tttgatgtcc |
26491034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University