View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8311_low_16 (Length: 236)
Name: NF8311_low_16
Description: NF8311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8311_low_16 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 18270547 - 18270317
Alignment:
| Q |
1 |
tcactgtttttgatacaggaaaccctatagattttatccaagtaccaaacaattggcttgtgccgatacaacacattcacctaggaaaacaaatgcaccc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18270547 |
tcactgtttttgatacaggaaaccctatagattttatccaagtatcaaacaattggcttgtgccgatacaacacattcacctaggaaaacaaatgcaccc |
18270448 |
T |
|
| Q |
101 |
cccacatcacacagagagggagaaggttcattttttacttcacggggttgaaagaaagattttatcatggccttgcacccacttgcaaagaggtcttcac |
200 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
18270447 |
cccacatcacacagaga-ggagaaggttcattttttacttcacggggttgaaagaaagattttatcatgcccttgcacccacttgcaaagaggtcttcac |
18270349 |
T |
|
| Q |
201 |
cagctgagcttttcaacatcttacatcgctca |
232 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |
|
|
| T |
18270348 |
cagctgagcttgtcaacatcttacatcgctca |
18270317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University