View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8311_low_18 (Length: 220)
Name: NF8311_low_18
Description: NF8311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8311_low_18 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 122 - 220
Target Start/End: Original strand, 5249021 - 5249116
Alignment:
| Q |
122 |
gagtaacttcttaaataattagcacactagttaaaccatgatttacatgtctaaattacaaatcattgtcttaacaagcattttttgtgtgtgtacttt |
220 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5249021 |
gagtaacttcttaaat---tagcacactagttaaaccatgatttacatgtctaaattacaaatcattgtcttaacaagcattttttgtgtgtgtacttt |
5249116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 9 - 88
Target Start/End: Original strand, 5248906 - 5248985
Alignment:
| Q |
9 |
taaaccaaccttaaaagtgaccaacaacagttaaacgtctttgaagagtcaaattataattatttacggttgaaccaact |
88 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5248906 |
taaaccaatcttaaaaatgaccaacaacagttaaacgtctttgaagagtcaaatgataattatttacggttgaaccaact |
5248985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University