View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8313_high_11 (Length: 341)
Name: NF8313_high_11
Description: NF8313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8313_high_11 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 128; Significance: 4e-66; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 16 - 182
Target Start/End: Original strand, 22575386 - 22575553
Alignment:
| Q |
16 |
attaactagtacaagttttagtaggtttccaaattctaattaaaacggttacattatgttattataaatatataaatcacaaagtaacttccccccaacc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
22575386 |
attaactagtacaagttttagtaggtttccaaattctaattaaaacggttacattatgttattataaataaataaatcaccaagtaacttccccccaacc |
22575485 |
T |
 |
| Q |
116 |
ataaatttcaagccgactattaat-nnnnnnnnttggtgaagaagactattaataatttatttaggct |
182 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
22575486 |
ataaatttcaagccgactattaataaaaaaaaattggtgaagaagactattaataatttatttaggct |
22575553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 200 - 232
Target Start/End: Original strand, 22575543 - 22575575
Alignment:
| Q |
200 |
ttatttaggcttcttcaagaaaaaatttattta |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
22575543 |
ttatttaggcttcttcaagaaaaaatttattta |
22575575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University