View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8313_low_13 (Length: 391)
Name: NF8313_low_13
Description: NF8313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8313_low_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 251; Significance: 1e-139; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 9 - 271
Target Start/End: Complemental strand, 41797112 - 41796850
Alignment:
| Q |
9 |
attattcttcattcctctcgggtttgttttctttgtattattgctttagttatgcatgatgcatgaatcagtactttcaaggacacaaggacggtggttt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41797112 |
attattcttcattcctctcgggtttgttttctttgtattattgctttagttatgcatgatgcatgaatcagtactttcaaggacacaaggacggtggttt |
41797013 |
T |
|
| Q |
109 |
cttctagatgaaagatacctttaagtttagagtttagaattgggataggttgtgataggtaatccccgcattcacgcggtcggtacattggtaagtgttg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
41797012 |
cttctagatgaaagatacctttaagtttagagtttagaattgggataggttgtgataggtaatccccgtattcacgcggtcggtacattggtaagtgttg |
41796913 |
T |
|
| Q |
209 |
gaaatccattcattcatgtagttggtacataagtgattattgaatcgagacgaggcatgctat |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
41796912 |
gaaatccattcattcatgtagttggtacataagtggttattgaatcgagatgaggcatgctat |
41796850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 328 - 391
Target Start/End: Complemental strand, 41796793 - 41796730
Alignment:
| Q |
328 |
gatctgattttgatccaacaattatcgatgtgtcaactatagggattgcgaattctagagttta |
391 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41796793 |
gatctgattttgatccaacaattatcaatgtgtcaactatagggattgcgaattctagagttta |
41796730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University