View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8313_low_15 (Length: 341)

Name: NF8313_low_15
Description: NF8313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8313_low_15
NF8313_low_15
[»] chr6 (2 HSPs)
chr6 (16-182)||(22575386-22575553)
chr6 (200-232)||(22575543-22575575)


Alignment Details
Target: chr6 (Bit Score: 128; Significance: 4e-66; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 16 - 182
Target Start/End: Original strand, 22575386 - 22575553
Alignment:
16 attaactagtacaagttttagtaggtttccaaattctaattaaaacggttacattatgttattataaatatataaatcacaaagtaacttccccccaacc 115  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||    
22575386 attaactagtacaagttttagtaggtttccaaattctaattaaaacggttacattatgttattataaataaataaatcaccaagtaacttccccccaacc 22575485  T
116 ataaatttcaagccgactattaat-nnnnnnnnttggtgaagaagactattaataatttatttaggct 182  Q
    ||||||||||||||||||||||||         |||||||||||||||||||||||||||||||||||    
22575486 ataaatttcaagccgactattaataaaaaaaaattggtgaagaagactattaataatttatttaggct 22575553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 200 - 232
Target Start/End: Original strand, 22575543 - 22575575
Alignment:
200 ttatttaggcttcttcaagaaaaaatttattta 232  Q
    |||||||||||||||||||||||||||||||||    
22575543 ttatttaggcttcttcaagaaaaaatttattta 22575575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University