View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8313_low_24 (Length: 251)
Name: NF8313_low_24
Description: NF8313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8313_low_24 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 99; Significance: 6e-49; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 124 - 251
Target Start/End: Complemental strand, 1108866 - 1108743
Alignment:
| Q |
124 |
ctatcaagtaaccccgtaatcaagttaatctataactaacttttctcaacttattagctaacttgtagcttaagaaacaaacaaactaaccacttattgt |
223 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
1108866 |
ctatcaagtaaccctgtaatcaagttaatctatcactaacttttctcaacttattagctaacttgtagcttaagaaacaaactaactaaccacttattg- |
1108768 |
T |
 |
| Q |
224 |
ttatttgaattacaaaactaatactcta |
251 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
1108767 |
---tttgaattacaaaactaatactcta |
1108743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 1108931 - 1108876
Alignment:
| Q |
1 |
gaagaataagagaatataaaaaactatgtgaatctcattgaatagagaaaatcaaa |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
1108931 |
gaagaataagagaatataaaaaactatgtgaatctcattgaatagagaagatcaaa |
1108876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 20 - 86
Target Start/End: Complemental strand, 33830300 - 33830234
Alignment:
| Q |
20 |
aaaactatgtgaatctcattgaatagagaaaatcaaatttacaaagtgcattaaccctatatatata |
86 |
Q |
| |
|
|||||| ||| ||||| ||||||| ||||| || || |||||||||||||||||||||||||||| |
|
|
| T |
33830300 |
aaaactgtgtaaatcttattgaatggagaagatgcaaaatacaaagtgcattaaccctatatatata |
33830234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University