View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8313_low_26 (Length: 238)
Name: NF8313_low_26
Description: NF8313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8313_low_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 16 - 193
Target Start/End: Original strand, 1108350 - 1108528
Alignment:
| Q |
16 |
atatgaacctgccttgtcagattataatcgacacttagatatgtcctttgctcatgtaaaacatataatactctagtatatgatctaagactgagacttc |
115 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1108350 |
atatgaacctgcttggtcagattataatcgacacttagatatgtcctttgctcatgtaaaacatataatactctagtatatgatctaagactgagacttc |
1108449 |
T |
 |
| Q |
116 |
aattatgaattgagacatatatgattttg-gaagaagggtttgaaggagaatgctggaactgttatttgattccaagaa |
193 |
Q |
| |
|
|||||||||||||||||||||||||| || |||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1108450 |
aattatgaattgagacatatatgattatgtgaagaagggtttgaaggaaaatgctggaactgttatttgattccaagaa |
1108528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University