View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8314_high_6 (Length: 329)
Name: NF8314_high_6
Description: NF8314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8314_high_6 |
 |  |
|
| [»] scaffold0449 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0449 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: scaffold0449
Description:
Target: scaffold0449; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 12 - 329
Target Start/End: Complemental strand, 3164 - 2848
Alignment:
| Q |
12 |
tgtttgaggagtcaactatgaaatgggagacttttcagaatttgtgtttgagatttaactaactttcctttcacttttcctattacactataaatagatt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3164 |
tgtttgaggagtcaactatgaaatgggagacttttcagaatttgtgtttgagatttaactaactttcctttcacttttcctattacactataaatagatt |
3065 |
T |
 |
| Q |
112 |
aatgaagtaccattagtaattcatttaaagttgtctatcatatcaggcaggcaggccctcatattctatagctacggggaacgtgtaaccctcctattca |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3064 |
aatgaagtaccattagtaattcatttaaagttgtctatcatatcaggcaggcaggccctcatattctatagctacggggaacgtgtaaccctcctattca |
2965 |
T |
 |
| Q |
212 |
accatgacctcnnnnnnnnntcttctttgagagatccaaatccacgagtatctttgcataatgcggatataatctattcttcgtaacgttgtcaataagt |
311 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||| |
|
|
| T |
2964 |
accatgacctc-ataaaaaatcttctttgagagatccaaatccacgagtatctttgcataatgccgatataatctattcttcgtaacattgtcaataagt |
2866 |
T |
 |
| Q |
312 |
aacggagagcaatctcat |
329 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
2865 |
aacggagagcaatctcat |
2848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University