View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8314_low_15 (Length: 205)
Name: NF8314_low_15
Description: NF8314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8314_low_15 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 6284430 - 6284242
Alignment:
| Q |
1 |
tagacatacacattaataatgatccaaactcctattagatatttggcttagatatttaaactcaccttaaccaagccaaaaccaagccttattagatcgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
6284430 |
tagacatacacattaataatgatccaaactcctattagatattt-------------aaactcaccttaaccaagccaaaaccaagctttattagatcgg |
6284344 |
T |
 |
| Q |
101 |
ttttgaataaatctttttgttggctaggaatcaacccattacatagtannnnnnnnnnnnnngaaagatcccataacatagtactccctccgtcccaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
6284343 |
ttttgaataaatctttttgttggctaggaatcaacccattacatagtatttttttttttt---aaagatcccataacatagtactccatccgtcccaaat |
6284247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 177 - 205
Target Start/End: Original strand, 39417794 - 39417822
Alignment:
| Q |
177 |
catagtactccctccgtcccaaattgtat |
205 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
39417794 |
catagtactccctccgtcccaaattgtat |
39417822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 205
Target Start/End: Complemental strand, 16524806 - 16524776
Alignment:
| Q |
175 |
aacatagtactccctccgtcccaaattgtat |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
16524806 |
aacatagtactccctccgtcccaaattgtat |
16524776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University