View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8316_high_29 (Length: 241)
Name: NF8316_high_29
Description: NF8316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8316_high_29 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 210; Significance: 1e-115; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 13 - 226
Target Start/End: Complemental strand, 17169736 - 17169523
Alignment:
| Q |
13 |
atcatcaacatttacttgtaaaatggttttattatgaactaagtctcacttgtaaaattgcagtatggtatgtcaaatgcactagcaacactatgtggcc |
112 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17169736 |
atcattaacatttacttgtaaaatggttttattatgaactaagtctcacttgtaaaattgcagtatggtatgtcaaatgcactagcaacactatgtggcc |
17169637 |
T |
|
| Q |
113 |
aagcttatggtgcaggaaaatttcaaaatgctggtatttatcttcaaaggtcatggatagtactcttcaccacttgtatactcctcttgccaattcttct |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17169636 |
aagcttatggtgcaggaaaatttcaaaatgctggtatttatcttcaaaggtcatggatagtactcttcaccacttgtatactcctcttgccaattcttct |
17169537 |
T |
|
| Q |
213 |
atatgcaactccaa |
226 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
17169536 |
atatgcaactccaa |
17169523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 47 - 226
Target Start/End: Complemental strand, 17151150 - 17150971
Alignment:
| Q |
47 |
tgaactaagtctcacttgtaaaattgcagtatggtatgtcaaatgcactagcaacactatgtggccaagcttatggtgcaggaaaatttcaaaatgctgg |
146 |
Q |
| |
|
|||||||| | |||| |||||||||||||| ||||||||||| ||| |||||||||| |||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
17151150 |
tgaactaaatatcacatgtaaaattgcagtttggtatgtcaacggcaatagcaacactgtgtggccaagcttatggtgcaggacaatttcaaaatgctgg |
17151051 |
T |
|
| Q |
147 |
tatttatcttcaaaggtcatggatagtactcttcaccacttgtatactcctcttgccaattcttctatatgcaactccaa |
226 |
Q |
| |
|
||||||| ||||||| ||| | || ||||||||||||||||||||||||| ||||||||| | ||||||||||||||| |
|
|
| T |
17151050 |
tatttatgttcaaagatcaagtattatactcttcaccacttgtatactcctattgccaattaatatatatgcaactccaa |
17150971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 49 - 226
Target Start/End: Complemental strand, 17137847 - 17137670
Alignment:
| Q |
49 |
aactaagtctcacttgtaaaattgcagtatggtatgtcaaatgcactagcaacactatgtggccaagcttatggtgcaggaaaatttcaaaatgctggta |
148 |
Q |
| |
|
|||||| | |||| ||||||||| |||| ||||||||||| ||||||||||||||| ||||||||||||||||||||| || ||||||||| |||||||| |
|
|
| T |
17137847 |
aactaaatttcacatgtaaaattacagtttggtatgtcaactgcactagcaacactctgtggccaagcttatggtgcaagacaatttcaaagtgctggta |
17137748 |
T |
|
| Q |
149 |
tttatcttcaaaggtcatggatagtactcttcaccacttgtatactcctcttgccaattcttctatatgcaactccaa |
226 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| ||||| ||||||| |||| | |||||||||| |||| |
|
|
| T |
17137747 |
tttatcttcaaaggtcatggattatactcttcaccacttgcatactaatcttgcctattcatatatatgcaaccccaa |
17137670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University