View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8316_high_31 (Length: 239)
Name: NF8316_high_31
Description: NF8316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8316_high_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 43244223 - 43244445
Alignment:
| Q |
1 |
taaagatagatttctttagagctaaccgaaagcaactatgtattgttttcctttataggaaggaacaaggaagaagaagagtgtaatagttggaccatgg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43244223 |
taaagatagatttctttagagctaaccgaaagcaactatgtattgtttttctttataggaaggaacaaggaagaagaagagtgtaatagttggaccatgg |
43244322 |
T |
 |
| Q |
101 |
ggaggtaatggtgggactagttgggatgatggaacctttacaggtataagagaaatcacactagtttatgatcgttgcattgactcaatccgtgtggttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43244323 |
ggaggtaatggtgggactagttgggatgatggaacctttacagggataagagaaatcacactagtttatgatcgttgcattgactcaatccgtgtggttt |
43244422 |
T |
 |
| Q |
201 |
atgataagaatggtaaacctttc |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
43244423 |
atgataagaatggtaaacctttc |
43244445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University