View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8316_high_40 (Length: 217)
Name: NF8316_high_40
Description: NF8316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8316_high_40 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 14100659 - 14100443
Alignment:
| Q |
1 |
gcactgcactctcatgttttgcactttattaacacgagtacatatttataaccactttgcctctctccacatgccaaagttaacgatgtgggacttcctt |
100 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
14100659 |
gcactgcactttcatgttttgcacttcattaacactagtacatatttataaccactttgcctctctccacataccaaagttaacgatgtgggacttcctt |
14100560 |
T |
 |
| Q |
101 |
caactatttgttttaaaactcaattataatgcaggcatcagaatgtggggcttttcttttgttatcaagagcccctcatgtacttataattttcacaatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14100559 |
caactatttgttttaaaactcaattataatgtaggcatcagaatgtggagcttctcttttgttatcaagagcccctcatgtacttataattttcacaatt |
14100460 |
T |
 |
| Q |
201 |
caacccttacatattaa |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
14100459 |
caacccttacatattaa |
14100443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 47 - 96
Target Start/End: Complemental strand, 14113322 - 14113272
Alignment:
| Q |
47 |
tataaccactttgcctctctcc-acatgccaaagttaacgatgtgggactt |
96 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
14113322 |
tatagccactttgcctctctcttacatgccaaagttaacgatgtgggactt |
14113272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University