View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8316_low_26 (Length: 265)
Name: NF8316_low_26
Description: NF8316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8316_low_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 119; Significance: 7e-61; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 18 - 148
Target Start/End: Original strand, 504027 - 504156
Alignment:
| Q |
18 |
tataaatggcacatagttgttttaaaacgatatgtaattaagaaatgaattaaaggatttaaataactggattatgttgctcgatgtatctctttccttc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
504027 |
tataaatggcacatagttgttttaaaacgatatgtaattaagaaatgaattaaaggatttaaataact-gattatgttgctcgatgtatctctttccttc |
504125 |
T |
|
| Q |
118 |
caataaaatgttcagtccttcatttttgttg |
148 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |
|
|
| T |
504126 |
caataaaatgttcagtccttcatttatgttg |
504156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University