View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8316_low_40 (Length: 228)
Name: NF8316_low_40
Description: NF8316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8316_low_40 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 15 - 210
Target Start/End: Original strand, 4153885 - 4154080
Alignment:
| Q |
15 |
tttcgtgttcagttcagtgccagggttgcattgcatgagatcatatttctgatgttaagtaaacttttaaccgtaataattatgagtcattttccaggat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4153885 |
tttcgtgttcagttcagtgccagggttgcattgcatgagatcatatttctgatgttaagtaaacttttaaccgtaataattatgagtcattttccaggat |
4153984 |
T |
|
| Q |
115 |
cagacaaataggtactgtgaaaataataaattcttgcgtctgtgttgaatgtttgccagagccagaggattcatgacattacctacccaactgcat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4153985 |
cagacaaataggtactgtgaaaataataaattcttgcgtctgtgttgagtgtttgccagagccagaggattcatgacattacctacccaactgcat |
4154080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University