View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8316_low_41 (Length: 227)
Name: NF8316_low_41
Description: NF8316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8316_low_41 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 23 - 227
Target Start/End: Original strand, 6887569 - 6887773
Alignment:
| Q |
23 |
tttgcgtaatcagcgcctgtgagtctttgttggaataattcatattctctaattgattattaaattgcaaaaagcatattatctttaccaatttttaaaa |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6887569 |
tttgcgtaatcagcgcctgtgagtctttgttggaataattcatattctctaattgattattaaattgcaaaaagcatattatctttaccaatttttaaaa |
6887668 |
T |
|
| Q |
123 |
gggttttgattccatagtaggtggcaagttttggaatgatatagaagaaaaggtagcggnnnnnnnggtgaaagagtgaagtgaagcttatggatttgag |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
6887669 |
gggttttgattccatagtaggtggcaagttttggaatgatatagaagaaaaggtagcggaaaaaaaggtgaaagagtgaagtgaagcttatggatttgag |
6887768 |
T |
|
| Q |
223 |
tgata |
227 |
Q |
| |
|
||||| |
|
|
| T |
6887769 |
tgata |
6887773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University