View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8316_low_43 (Length: 225)
Name: NF8316_low_43
Description: NF8316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8316_low_43 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 160; Significance: 2e-85; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 14 - 205
Target Start/End: Original strand, 35951925 - 35952116
Alignment:
| Q |
14 |
attattctttgtagttgtgccttcgtgattcgggaggacagtttgtagcagcgcaaacgatgtctcgacaagcacatacattggttttagagggagaggc |
113 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| ||||||| |||||||||||||||||||| |
|
|
| T |
35951925 |
attattctctatagttgtgccttcgtgattcgggaggacagtttgtagcagcgcaaacgatgccgcgacaatcacatacgttggttttagagggagaggc |
35952024 |
T |
 |
| Q |
114 |
gatagctatccgttttgcccatgctaaggggtgggatatagtgatttttgaataagattctagtactttggttgatgccctttcaacgcaac |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
35952025 |
gatagctatccgttttgcccatgctaaggggtgggatatagtgatttttgaataagattctagtaatttggttaatgccctttcaacgcaac |
35952116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 31 - 205
Target Start/End: Complemental strand, 22930038 - 22929852
Alignment:
| Q |
31 |
tgccttcgtgattcgggaggacagtttgtagcagcgcaaacgatgtctcgacaagcacatacattggttttagagggagaggcgat------------ag |
118 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||||| | |||||||||| | ||||||| ||| ||||| ||| || |
|
|
| T |
22930038 |
tgccttcgtgaatcgggaggtacgtttgtagcagcgcaaacgatgtggcagcaagcacatatgtcggttttaaaggaagaggtgatggcccttttggaag |
22929939 |
T |
 |
| Q |
119 |
ctatccgttttgcccatgctaaggggtgggatatagtgatttttgaataagattctagtactttggttgatgccctttcaacgcaac |
205 |
Q |
| |
|
|||||| ||||||| |||||||||||||| || |||||||||||||| ||||| ||||||||||||| | ||||| |||||||||| |
|
|
| T |
22929938 |
ctatccaatttgcccgtgctaaggggtggggtaaagtgatttttgaatcagattatagtactttggttaacgccctctcaacgcaac |
22929852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University