View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8317_high_4 (Length: 257)
Name: NF8317_high_4
Description: NF8317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8317_high_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 14 - 241
Target Start/End: Complemental strand, 34259689 - 34259462
Alignment:
| Q |
14 |
cctgtggttctgtcagggatgcagaaattatgcttgatcagctcagtttgcttggtaaaaagatcaaaatttccttagtttatgagcttgtaagtatagt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34259689 |
cctgtggttctgtcagggatgcagaaattatgcttgatcaactcagtttgcttggtaaaaagatcaaaatttccttagtttatgagcttgtaagtatagt |
34259590 |
T |
|
| Q |
114 |
tctttagttccatacttgttcctcaaaacnnnnnnnnnnnnnncctagtgatcaaccttgtcctttgttgttatgcagactgggattgtttcagatgatg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34259589 |
gctttagttccatacttgttcctcaaaacttttttaattttttcctagtgatcaaccttgtcctttgttgttatgcagactgggattgtttcagacgatg |
34259490 |
T |
|
| Q |
214 |
aattgcttgatttgcttgatctggcttt |
241 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
34259489 |
aattgcttgatttgcttgatctggcttt |
34259462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 16 - 108
Target Start/End: Complemental strand, 43111851 - 43111759
Alignment:
| Q |
16 |
tgtggttctgtcagggatgcagaaattatgcttgatcagctcagtttgcttggtaaaaagatcaaaatttccttagtttatgagcttgtaagt |
108 |
Q |
| |
|
||||||||| | ||||| |||||||| |||||||||||||| ||||||||||||||||| |||| |||||||||||| || || ||||||||| |
|
|
| T |
43111851 |
tgtggttctcttagggacgcagaaatgatgcttgatcagctaagtttgcttggtaaaaaaatcacaatttccttagtctacgaacttgtaagt |
43111759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 170 - 229
Target Start/End: Complemental strand, 43111672 - 43111613
Alignment:
| Q |
170 |
cttgtcctttgttgttatgcagactgggattgtttcagatgatgaattgcttgatttgct |
229 |
Q |
| |
|
|||| |||||||| || ||||||||||| | |||| ||||||||||||||||||||||| |
|
|
| T |
43111672 |
cttgccctttgtttttctgcagactggggtcatttctgatgatgaattgcttgatttgct |
43111613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University