View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8319A_high_16 (Length: 316)
Name: NF8319A_high_16
Description: NF8319A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8319A_high_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 15 - 271
Target Start/End: Original strand, 40557158 - 40557414
Alignment:
| Q |
15 |
aaaaaagggaggaagaagatcgtcggtatgcacgtgtccgtgttggatcccaatcttatactctacaaagacatgtgcttcaagaagtggaaaatggtga |
114 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40557158 |
aaaaaagggaggaagaagattgttggtatgcccgtgttcgtgttggatcccaatcttatactctacaaagacatgtgcttcaagaagtggaaaatggtga |
40557257 |
T |
 |
| Q |
115 |
ctggagaggtctacattatcacaaacaaatggaacgaacttgtagcagaaaaccgtttcaaagccaagaaaaaggtgcaactctggtcttttagatgccg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40557258 |
ctggagaggtctacattatcacaaacaaatggaacgaacttgtagcagaaaaccgtttcaaagccaagaaaaaggtgcaactttggtcttttagatgccg |
40557357 |
T |
 |
| Q |
215 |
tggtgaactctacttcgcactcgtcaagctctagccaagttctattagtcaatgatg |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
40557358 |
tggtgaactctacttcgcactcgtcaagctctagccaagttctatcagtcaatgatg |
40557414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University