View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8319A_high_21 (Length: 305)
Name: NF8319A_high_21
Description: NF8319A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8319A_high_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 25 - 297
Target Start/End: Complemental strand, 52990255 - 52989983
Alignment:
| Q |
25 |
catggaaggtctctctctattgtgccaaatccagaaaaggtgacagaatttgaaaattttcctggagaaggaatctgtggaaaaattgatgagagagttc |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52990255 |
catggaaggtctctctctattgtgccaaatccagaaaaggtgacagaatttgaaaattttcctggagaaggaatctgtggaaaaattgatgagagagttc |
52990156 |
T |
 |
| Q |
125 |
tgtacattggaaacaaaaagatagcaacaagagcagggtctgaaacaggtgagaaagcccttgcctacagtgacattacatgtttgaggccaattgaatt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52990155 |
tgtacattggaaacaaaaagatagcaacaagagcagggtctgaaacaggtgagaaagcccttgcctacagtgacattacatgtttgaggccaattgaatt |
52990056 |
T |
 |
| Q |
225 |
gaagtgtaacattgtttcaatataatcctgtctattagcttatgacctttgatcgttgtgttttattttcttc |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
52990055 |
gaagtgtaacattgtttcaatataatcctgtctattagcttatgacctttgatcattgtgttttattttcttc |
52989983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University