View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8319A_high_29 (Length: 207)
Name: NF8319A_high_29
Description: NF8319A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8319A_high_29 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 82; Significance: 6e-39; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 82; E-Value: 6e-39
Query Start/End: Original strand, 6 - 96
Target Start/End: Complemental strand, 25633927 - 25633835
Alignment:
| Q |
6 |
acatttttcacaagaaactcgtcattttatgt--atatatcatttctttggtgtttcagcttatataccagaatagttttcagagaaatatgc |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25633927 |
acatttttcacaagaaactcgtcattttatgtgtatatatcatttctttggtgtttcagcttatataccagaatagttttcagagaaatatgc |
25633835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University