View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8319A_low_10 (Length: 450)
Name: NF8319A_low_10
Description: NF8319A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8319A_low_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 155; Significance: 4e-82; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 155; E-Value: 4e-82
Query Start/End: Original strand, 82 - 244
Target Start/End: Complemental strand, 6417311 - 6417149
Alignment:
| Q |
82 |
ctaatccttttccttagattaacactttgattttaacaaatccaccgtgatatcaaactcaccctgatgctatagtgacgacgggatgcaactccaccgg |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
6417311 |
ctaatccttttccttagattaacactttgattttaacaaatccaccgtgatatcaaactcacgctaatgctatagtgacgacgggatgcaactccaccgg |
6417212 |
T |
|
| Q |
182 |
agatggtgtaccaaacaatagtcgactagttaaggctaatgcgctcaagggcatgtcaatact |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6417211 |
agatggtgtaccaaacaatagtcgactagttaaggctaatgcgctcaagggcatgtcaatact |
6417149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 3 - 101
Target Start/End: Complemental strand, 6417421 - 6417323
Alignment:
| Q |
3 |
tatattcattaattagtatatcgagactttctttgggttgcaccaattgagtggcttgccagtgccacaagttcttctgctaatccttttccttagatt |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6417421 |
tatattcattaattagtatatcgagactttctttgggttgcaccaattgagtggcttgccagtgccacaagttcttctgctaatccttttccttagatt |
6417323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 245 - 346
Target Start/End: Complemental strand, 6417105 - 6417004
Alignment:
| Q |
245 |
gtgtatttctctcatgtgtgatcttaactctttattaaagaggtgagagagtgacttttaatattaaaaatggaaagagggtataattaatggccgagat |
344 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6417105 |
gtgtatttctctcatgtgtgatcttaactctttattaaagaggtgagagagtgacttttaatattaaaaatggaaagagggtataattaatggctgagat |
6417006 |
T |
|
| Q |
345 |
ca |
346 |
Q |
| |
|
|| |
|
|
| T |
6417005 |
ca |
6417004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 372 - 444
Target Start/End: Complemental strand, 6417007 - 6416935
Alignment:
| Q |
372 |
atcactggagatgatcctctcccattgtttggattgtgtttgcttcacatttctcgcgctcccatgtgccatg |
444 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||| ||||||| ||||||||||||||| ||||| |
|
|
| T |
6417007 |
atcactggagatgatcctctcccattgtttggattgcgtttgcctcacattcctcgcgctcccatgtaccatg |
6416935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University