View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8319A_low_105 (Length: 259)
Name: NF8319A_low_105
Description: NF8319A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8319A_low_105 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 3 - 222
Target Start/End: Original strand, 4054910 - 4055130
Alignment:
| Q |
3 |
gatgtcgaagaaaatgatgacccgacccaccgacccaataaccctattcggattttactttgtgtagacacttcgagagaaaaacacat-aaacacagtc |
101 |
Q |
| |
|
|||||| || |||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
4054910 |
gatgtccaataaaacgatgacccgacccaccgacccaataaccctattcggatcttactttgtgtagacagttcgagagaaaaacacattaaacacagtg |
4055009 |
T |
 |
| Q |
102 |
aaacttcgaaacaaagagtgtcttctgaaacaatttttgttttgtttaccgttggtgtttagtaagacatatcaatgttgttggggaagagaaacagaga |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4055010 |
aaacttcgaaacaaagagtgtcttctgaaacaaattttgttttgtttaacgttggtgtttagaaagacatatcaatgttgttggggaagagaaacagaga |
4055109 |
T |
 |
| Q |
202 |
aacaaagatattactgttatg |
222 |
Q |
| |
|
||||||||||| ||||||||| |
|
|
| T |
4055110 |
aacaaagatatcactgttatg |
4055130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University