View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8319A_low_138 (Length: 245)
Name: NF8319A_low_138
Description: NF8319A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8319A_low_138 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 33127893 - 33128122
Alignment:
| Q |
1 |
tgacaacttgaactactagcattgttataaaaagctgaattaacgacgaaaa-aataattattctctcattttgtcgtcttaaacacttaacgactgaat |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
33127893 |
tgacaacttgaactactagcattgttataaaaagctgaattaacgacgaaaaaaataattattctcccattttgtcgtcttaaacacttaacgactgaat |
33127992 |
T |
|
| Q |
100 |
tagagatggatttcttgtttttcgaatacatgtaacataatttgttgatttttgcaggtgccattatatcttgctgcacaagtgctaggatctgtccttg |
199 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33127993 |
tagagatggatttcttgtttttcgaacacatgtaacataatttgttgatttttgcaggtgccattatatcttgctgcacaagtgctaggatctgtccttg |
33128092 |
T |
|
| Q |
200 |
ctagtggaacattgtaccttctttttgatg |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
33128093 |
ctagtggaacattgtaccttctttttgatg |
33128122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University